The 4 persons in God
Sept 30, 2016 12:52:15 GMT
Post by Colossians on Sept 30, 2016 12:52:15 GMT
This material is for the teaching of the Body of Christ, however the author reserves copyright over it.
_____________________
THE 4 PERSONS IN GOD
Delineation and delimitation
The noun phrase:
“the city of New York”,
is what the grammarian refers to as “appositive genitive”: being essentially placed side-by-side, “the city” and “New York” are considered to exhaust one another so that they are said to refer to the exact same thing at the exact same time: it is not “the city that is in New York”, but “the city that is (itself) New York”.
___
By the same token, when we say “the 3 persons of God”, we are in fact saying “the 3 persons who are God”: we are referring to the Godhead.
___
Therefore when we refer to the 4 persons who are “in” God (the title of this work), we do not intend “the 4 persons who are God” (we do not intend “the Godhead”, even if some or all of such persons might in fact be part of the Godhead), but are simply referring to membership within God in abstraction from (the authority that is) “God”.
___
The 3 persons of God
God the Father
God the Son
God the Holy Spirit
The 4 persons in God
God the Father
God the Son: Head (Husband)
God the Son: Body (Bride/Church)
God the Holy Spirit
(See 1 Cor 6:17, Eph 1:4.)
Implications
1. Given that it is the church and not the world which worships God, and setting aside the angels (who require separate consideration), all worshipping of God is of necessity internal to the person of God.
2. That which follows as corollary of (1) is that the statement by the apostle John that God “is” love, relates the metaphysical fact that love actually begins and ends at the ‘perimeter’ of God’s person – that love is internal to God rather than that which might proceed from Him to one external to Him, and which is in fact conversely analogous to the human body’s rejection of organs previously belonging to another person.
3. Given that there can be no improvement on being joined to Christ as one, then the greatest activity of the Bride - her worshipping of Christ – is of necessity coextensive with her being joined to Him: the state that consists of oneness with her Husband, and the dynamic that consists of the praising of her Husband, are simply (the) 2 (-only) aspects of the exact same thing. (Cf. 1 Pe 3:6.)
4. Given that the Son is eternally a full person and therefore of necessity eternally Head + Body, then the Bride which is the Body is of necessity eternally elect, and solely so.
5. Although the person of the Bride is not part of the Godhead, she is nevertheless of necessity (organically) componential to all the ‘decisions’ of the Godhead.
Affirming via the shadows
Biochemistry
If God is (spiritual) life (i.e. if He is truly “the Life”), then if what we have outlined in this document is true, we should expect to find the same ‘structure’ in the material world as type, and most particularly, at the very fundamental level.
The information source of all material life, DNA, consists of a double-stranded helix, the spine of each strand consisting (among other things) of 4 nitrogenous, hetero-cyclic bases.
The 4 bases are:
Adenine
Thymine
Guanine
Cytosine
which for brevity’s sake are referred to as “the As”, “the Ts”, “the Gs” and “the Cs”.
However each instruction formed by these 4 bases in fact consists of only 3 of the bases. So in the hypothetical DNA strand:
TGGCGACACTTGAACTAAAGTTAC
the instructions represented are not
TGGC GACA CTTG AACT AAAG TTAC
but
TGG CGA CAC TTG AAC TAA AGT TAC.
That is, God has signified in the source of all natural life, that there are 4 persons in the source of all spiritual life, and that they are expressed by a 3-person decision-maker.
History
We have pointed to the DNA of life:
Adenine
Thymine
Guanine
Cytosine
When Christ who is the source of all spiritual life came to dwell among men, Rome ruled, and most significantly, not as a (mere) republic, but for the first time in history, an empire: the ceasar who ruled when Christ was born, was the first ceasar of the Roman Empire, and not only so, but the first-mentioned ceasar in scripture.
And what will be shown to be of equal significance, is that the fourth ceasar of the Roman Empire, was the last-mentioned ceasar in scripture.
The first 4 ceasars of the Roman empire, beginning with him who ruled when Christ was born:
Augustus
Tiberias
Gaius1
Claudius
1 The alternate name for Gaius, “Caligula”, was merely that by which he was popularly called.
That is, God signified in the rulers of the empire extant at the time of Christ and the early church, that He who was Life had (finally) arrived.
Granted, the (overwhelming) coincidence of such names with the base letters of DNA may not hold in many other languages, but given that the English language uses the Roman alphabet, we believe we are justified in what we have pointed out. Indeed, we may further affirm our correlations by pointing out that, although scripture spans the 4 ceasars we have listed, Gaius is omitted: again, 4 persons, but 3 decision-makers.
Amen.
(See also our works on Statal Calvinism.)
_____________________
THE 4 PERSONS IN GOD
Delineation and delimitation
The noun phrase:
“the city of New York”,
is what the grammarian refers to as “appositive genitive”: being essentially placed side-by-side, “the city” and “New York” are considered to exhaust one another so that they are said to refer to the exact same thing at the exact same time: it is not “the city that is in New York”, but “the city that is (itself) New York”.
___
By the same token, when we say “the 3 persons of God”, we are in fact saying “the 3 persons who are God”: we are referring to the Godhead.
___
Therefore when we refer to the 4 persons who are “in” God (the title of this work), we do not intend “the 4 persons who are God” (we do not intend “the Godhead”, even if some or all of such persons might in fact be part of the Godhead), but are simply referring to membership within God in abstraction from (the authority that is) “God”.
___
The 3 persons of God
God the Father
God the Son
God the Holy Spirit
The 4 persons in God
God the Father
God the Son: Head (Husband)
God the Son: Body (Bride/Church)
God the Holy Spirit
(See 1 Cor 6:17, Eph 1:4.)
Implications
1. Given that it is the church and not the world which worships God, and setting aside the angels (who require separate consideration), all worshipping of God is of necessity internal to the person of God.
2. That which follows as corollary of (1) is that the statement by the apostle John that God “is” love, relates the metaphysical fact that love actually begins and ends at the ‘perimeter’ of God’s person – that love is internal to God rather than that which might proceed from Him to one external to Him, and which is in fact conversely analogous to the human body’s rejection of organs previously belonging to another person.
3. Given that there can be no improvement on being joined to Christ as one, then the greatest activity of the Bride - her worshipping of Christ – is of necessity coextensive with her being joined to Him: the state that consists of oneness with her Husband, and the dynamic that consists of the praising of her Husband, are simply (the) 2 (-only) aspects of the exact same thing. (Cf. 1 Pe 3:6.)
4. Given that the Son is eternally a full person and therefore of necessity eternally Head + Body, then the Bride which is the Body is of necessity eternally elect, and solely so.
5. Although the person of the Bride is not part of the Godhead, she is nevertheless of necessity (organically) componential to all the ‘decisions’ of the Godhead.
Affirming via the shadows
Biochemistry
If God is (spiritual) life (i.e. if He is truly “the Life”), then if what we have outlined in this document is true, we should expect to find the same ‘structure’ in the material world as type, and most particularly, at the very fundamental level.
The information source of all material life, DNA, consists of a double-stranded helix, the spine of each strand consisting (among other things) of 4 nitrogenous, hetero-cyclic bases.
The 4 bases are:
Adenine
Thymine
Guanine
Cytosine
which for brevity’s sake are referred to as “the As”, “the Ts”, “the Gs” and “the Cs”.
However each instruction formed by these 4 bases in fact consists of only 3 of the bases. So in the hypothetical DNA strand:
TGGCGACACTTGAACTAAAGTTAC
the instructions represented are not
TGGC GACA CTTG AACT AAAG TTAC
but
TGG CGA CAC TTG AAC TAA AGT TAC.
That is, God has signified in the source of all natural life, that there are 4 persons in the source of all spiritual life, and that they are expressed by a 3-person decision-maker.
History
We have pointed to the DNA of life:
Adenine
Thymine
Guanine
Cytosine
When Christ who is the source of all spiritual life came to dwell among men, Rome ruled, and most significantly, not as a (mere) republic, but for the first time in history, an empire: the ceasar who ruled when Christ was born, was the first ceasar of the Roman Empire, and not only so, but the first-mentioned ceasar in scripture.
And what will be shown to be of equal significance, is that the fourth ceasar of the Roman Empire, was the last-mentioned ceasar in scripture.
The first 4 ceasars of the Roman empire, beginning with him who ruled when Christ was born:
Augustus
Tiberias
Gaius1
Claudius
1 The alternate name for Gaius, “Caligula”, was merely that by which he was popularly called.
That is, God signified in the rulers of the empire extant at the time of Christ and the early church, that He who was Life had (finally) arrived.
Granted, the (overwhelming) coincidence of such names with the base letters of DNA may not hold in many other languages, but given that the English language uses the Roman alphabet, we believe we are justified in what we have pointed out. Indeed, we may further affirm our correlations by pointing out that, although scripture spans the 4 ceasars we have listed, Gaius is omitted: again, 4 persons, but 3 decision-makers.
Amen.
(See also our works on Statal Calvinism.)